SubtiBank SubtiBank
yngC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yngC

similar to alkaline phosphatase
locus
BSU_18190
pI
9.77
mw
21.78 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,947,668 1,948,264

    The protein

    Protein family

  • dedA family (with [protein|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|YbfM] and [protein|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|YkoX], according to UniProt)
  • Paralogous protein(s)

  • [protein|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|YbfM]
  • [protein|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|YkoX]:
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CBCBF948979D9D63CBA86A9ED865E43B1F85A0AD|yngA]-[gene|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|yngB]-[gene|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]
    description
    [Pubmed|20512483]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ]: activation, [Pubmed|20512483], in [regulon|706983E6942E883D3A9D45693E7B4015AEABE60B|YclJ regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    genes
    [gene|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]
    description
    [Pubmed|18179421]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B397 (yngC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1396 NBRP B. subtilis, Japan]
  • BKE18190 ([gene|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCTTCACAACCTGTC, downstream forward: _UP4_TAGCTAGCGGATATGCATAG
  • BKK18190 ([gene|289828D37CF5422908316ED2EF1AEAE76F84161D|yngC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCTTCACAACCTGTC, downstream forward: _UP4_TAGCTAGCGGATATGCATAG
  • References

  • 20512483,18179421