SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


40.68 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast
glucomannan utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucomannan]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    632,774 633,862

    The protein

    Catalyzed reaction/ biological activity

  • Random hydrolysis of (14)-beta-D-mannosidic linkages in mannans, galactomannans and glucomannans (according to UniProt)
  • Protein family

  • glycosyl hydrolase 26 family (single member, according to UniProt)
  • [SW|Domains]

  • GH26 domain (aa 38-349) (according to UniProt)
  • Structure

  • [PDB|2QHA], [ 3CBW] mutant variant
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18177310], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]: repression, [Pubmed|18177310], in [regulon|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18177310], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by cellobiose ([protein|64CA75A26A08C534EC7ADFC4A6256F07F3D4BFB7|GmuR]) [Pubmed|18177310]
  • view in new tab

    Biological materials


  • MGNA-C195 (ydhT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05880 ([gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCAACTCCCCCATTC, downstream forward: _UP4_TGAATCCGTAATGTCACAAT
  • BKK05880 ([gene|289ACC9D13BBFAA5C083EE525ECCC32DB06E075F|gmuG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCAACTCCCCCATTC, downstream forward: _UP4_TGAATCCGTAATGTCACAAT
  • References

  • 19504356,18177310,18957862,19441796,20709850,20817675,24421132