SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


primary manganese (II) efflux pump
32.64 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
Mn(II) export
manganese (II) efflux pump

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    595,109 596,002

    Phenotypes of a mutant

  • sensitive to Mn(II) [Pubmed|27748968]
  • a [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS] double mutant is extremely senitive to Mn2+ intoxication [pubmed|31685536]
  • The protein

    Catalyzed reaction/ biological activity

  • efflux of Mn(II) [Pubmed|27748968]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
  • Paralogous protein(s)

  • [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS], [protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|YdbO]
  • Structure

  • [PDB|5VRF] (Shewanella oneidensis zinc transporter, 26% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|27748968], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: transcription activation, [Pubmed|27748968], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • expressed at elevated Mn(II) concentrations ([protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]) [Pubmed|27748968]
  • view in new tab

    Biological materials


  • MGNA-C152 (ydfM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA, downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
  • BKK05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA, downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
  • References

  • 27748968,29507252,31685536