SubtiBank SubtiBank
mneP
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mneP

primary manganese (II) efflux pump
locus
BSU_05470
pI
6.16
mw
32.64 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
Mn(II) export
product
manganese (II) efflux pump
essential
no
synonyms
ydfM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.13|Metal ion exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.2|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    595,109 596,002

    Phenotypes of a mutant

  • sensitive to Mn(II) [Pubmed|27748968]
  • a [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS] double mutant is extremely senitive to Mn2+ intoxication [pubmed|31685536]
  • The protein

    Catalyzed reaction/ biological activity

  • efflux of Mn(II) [Pubmed|27748968]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
  • Paralogous protein(s)

  • [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS], [protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|YdbO]
  • Structure

  • [PDB|5VRF] (Shewanella oneidensis zinc transporter, 26% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|27748968], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: transcription activation, [Pubmed|27748968], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • expressed at elevated Mn(II) concentrations ([protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]) [Pubmed|27748968]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C152 (ydfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2150 NBRP B. subtilis, Japan]
  • BKE05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA, downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
  • BKK05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA, downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
  • References

  • 27748968,29507252,31685536