SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


primary manganese (II) efflux pump
32.64 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
Mn(II) export
manganese (II) efflux pump

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion exporters]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    595,109 596,002

    Phenotypes of a mutant

  • sensitive to Mn(II) [Pubmed|27748968]
  • a [gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP] [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS] double mutant is extremely senitive to Mn2+ intoxication [pubmed|31685536]
  • The protein

    Catalyzed reaction/ biological activity

  • efflux of Mn(II) [Pubmed|27748968]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] [Pubmed|27748968]
  • Paralogous protein(s)

  • [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS], [protein|D52111E81E9233DABAEFCAF6217145CF6A7F3961|YdbO]
  • Structure

  • [PDB|5VRF] (Shewanella oneidensis zinc transporter, 26% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|27748968], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: transcription activation, [Pubmed|27748968], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • expressed at elevated Mn(II) concentrations ([protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]) [Pubmed|27748968]
  • view in new tab

    Biological materials


  • MGNA-C152 (ydfM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA, downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
  • BKK05470 ([gene|28C7CFE5701F6920652BE1973DC7A15D7C088E35|mneP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTCCTCCTATAAAA, downstream forward: _UP4_TGAAAAGCTCCTTTTTAGAA
  • References

  • 27748968,29507252,31685536