SubtiBank SubtiBank
bsdA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bsdA

transcriptional activator of the [gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD] operon
locus
BSU_03620
pI
5.99
mw
32.83 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
regulation of resistance to salicylic acid
product
transcriptional activator ([SW|LysR family])
essential
no
synonyms
yclA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    411,578 412,450

    The protein

    Catalyzed reaction/ biological activity

  • transcriptional activation of the ''[gene|8A83E44AFE9A1A635C65E6B526690AF7DA201BE1|bsdB]-[gene|FD23F4C2AFCBFE35A79116C5A707FACD454E4180|bsdC]-[gene|868DC9DE1C9C26C780F4CEAA4185640B5B6B781B|bsdD]'' operon in response to salicylic acid
  • Protein family

  • [SW|LysR family] (according to UniProt)
  • [SW|Domains]

  • [SW|HTH lysR-type domain] (aa 1-59) (according to UniProt)
  • Structure

  • [PDB|2H99] (from Acinetobacter baylyi, 29% identity) [pubmed|19400783]
  • Biological materials

    Mutant

  • MGNA-C060 (yclA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2058 NBRP B. subtilis, Japan]
  • BKE03620 ([gene|28D03575FA24525C162E6C161631034568E89622|bsdA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAAGCGCCTCCTTA, downstream forward: _UP4_TAAAAGATTTTGTCTTATGA
  • BKK03620 ([gene|28D03575FA24525C162E6C161631034568E89622|bsdA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAGAAAGCGCCTCCTTA, downstream forward: _UP4_TAAAAGATTTTGTCTTATGA
  • References

  • 17295427,19400783