SubtiBank SubtiBank
yqjB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqjB

putative sporulation-specific L,D-transpeptidase
locus
BSU_23940
pI
5.27
mw
19.55 kDa
protein length
176 aa Sequence Blast
gene length
531 bp Sequence Blast
function
unknown
product
putative L,D-transpeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,488,953 2,489,483

    The protein

    Protein family

  • YkuD family (with [protein|456AF184261976FAA73359E81443F7035F457D07|YciB] and [protein|6F256986E591DB82974A7F54EB1CE0C024A6F63B|Ldt], according to UniProt)
  • Paralogous protein(s)

  • [protein|6F256986E591DB82974A7F54EB1CE0C024A6F63B|Ldt]
  • Structure

  • [PDB|4A1I] ([protein|6F256986E591DB82974A7F54EB1CE0C024A6F63B|Ldt], 41% identity)
  • [SW|Localization]

  • contains a signal peptide for secretion (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]-[gene|E993FA7270DB71B055A36E305D8759BFD4C21ACF|yqjC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|26577401], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [pubmed|26577401], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C385 (yqjB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2383 NBRP B. subtilis, Japan]
  • BKE23940 ([gene|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCTCCTCCTTTTTCA, downstream forward: _UP4_TAAGGCGCCTGCTTTTTTAT
  • BKK23940 ([gene|293794B65B9EEB7F049138F73893303BABFB9A2A|yqjB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGCTCCTCCTTTTTCA, downstream forward: _UP4_TAAGGCGCCTGCTTTTTTAT