SubtiBank SubtiBank
rhaM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rhaM

mutarotase involved in rhamnose utilization
locus
BSU_31190
pI
5.18
mw
12.44 kDa
protein length
104 aa Sequence Blast
gene length
315 bp Sequence Blast
function
utilization of rhamnose
product
mutarotase
essential
no
synonyms
yulD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.12|Utilization of rhamnose]
  • Gene

    Coordinates
    3,199,233 3,199,547

    The protein

    Catalyzed reaction/ biological activity

  • α-L-rhamnose --> β-L-rhamnose (according to UniProt)
  • Protein family

  • rhamnose mutarotase family (single member, according to UniProt)
  • Structure

  • [PDB|1X8D] (from E. coli, 55% identity) [pubmed|15876375]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C32AE30BF7931D6171E9DE75C67504F81DD0F227|rhaEW]-[gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|26712933,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|26712933], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR]: repression, [Pubmed|26712933], in [regulon|F574142C1E61788FF8F4B61280AD4F87292D08DF|RhaR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|26712933], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    genes
    [gene|F574142C1E61788FF8F4B61280AD4F87292D08DF|rhaR]-[gene|693040A5BA7A25AD485B7B28DBD6E8AAC77450F7|rhaB]-[gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]-[gene|FDDC16D57752D81299CDD426257C1CD49890C89C|rhaA]
    description
    [Pubmed|22383849]

    regulation

  • expression during spore [SW|germination] is increased under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A639 (yulD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/639 NBRP B. subtilis, Japan]
  • BKE31190 ([gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTTTCACCTCTTCA, downstream forward: _UP4_TGAAAAACTGATAAAGGGAG
  • BKK31190 ([gene|294C0CC675088B2A2EEFC26FAF1A628002B82C59|rhaM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACCTTTTCACCTCTTCA, downstream forward: _UP4_TGAAAAACTGATAAAGGGAG
  • References

  • 26712933,24391637,22383849,27766092,15876375