SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


DNA-3-methyladenine glycosylase
35.48 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
adaptive response to alkylative DNA damage
DNA-3-methyladenine glycosylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • Gene

    202,547 203,458

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of alkylated DNA, releasing 3-methyladenine, 3-methylguanine, 7-methylguanine and 7-methyladenine (according to UniProt)
  • Protein family

  • alkylbase DNA glycosidase AlkA family (with [protein|82CDC97D16426016CA7E75240C1A6D0D600F4375|YfjP], according to UniProt)
  • Structure

  • [PDB|2JHJ] (from Archaeoglobus fulgidus, 29% identity) [pubmed|17396151]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8376346], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA]: positive regulation, in [regulon|0F8A564256A598DB3A36668FA0C984542FE1323F|AdaA regulon]
  • view in new tab

    Biological materials


  • BKE01800 ([gene|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|alkA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTCATTCTCCTTAT, downstream forward: _UP4_TGAATCATTTCAACTTTAAC
  • BKK01800 ([gene|297DF91EF3E91A6D2DC39BBC7FE8711AB7EBE509|alkA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTCATTCTCCTTAT, downstream forward: _UP4_TGAATCATTTCAACTTTAAC
  • References


  • 22933559,24810496
  • Original publications

  • 8376346,17396151