The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit (class III heat-shock protein)
function
protein degradation
product
AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit
Genomic Context
categories
[category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]Gene
Coordinates
2,884,781 2,886,043
Phenotypes of a mutant
increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]the mutation suppresses the heat sensitivity of spores overexpressing ''[gene|85DE3CB6CDA61C141C6030367C0A13BB642160B9|cmpA]'' [Pubmed|26387458]The protein
Catalyzed reaction/ biological activity
ATPase/chaperoneProtein family
ClpX chaperone family (with [protein|2A5A080273CB7698DFABB147F4143E90BBCA3B01|ClpY], according to UniProt)[SW|Domains]
AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]Zinc finger [http://pfam.sanger.ac.uk/family?acc=PF06689 PFAM]Structure
[PDB|1UM8] (from ''Helicobacter pylori'') [Pubmed|14514695][SW|Localization]
cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [Pubmed|18786145,18689473]Expression and Regulation
Operons
genes
[gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]
description
[Pubmed|11325926]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8973311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]regulatory mechanism
[protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|9852015], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]regulation
induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]view in new tabBiological materials
Mutant
MGNA-B019 (clpX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1018 NBRP B. subtilis, Japan]GPUG2 (aphA3), available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labsGP1787 (aphA3), available in [SW|Jörg Stülke]'s lab''clpX::kan'', ''clpX::spec'' and ''clpX::cat'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] LabBKE28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC, downstream forward: _UP4_TAAAGATAAGCACAAACCTCBKK28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC, downstream forward: _UP4_TAAAGATAAGCACAAACCTCGFP fusion
C-terminal GFP fusions (both single copy and 2th copy in ''amyE'' locus, also as CFP and YFP variants) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lablabs
[SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]References
Reviews
23375660,19680248,17302811,23479438,19609260,26639779,28748186 Original Publications
12761164,10809708,9643546,11807061,14679237,18689476,16899079,8973311,19136590,11325926,8973311,9852015,18689473,20525796,15948963,18786145,24417481,24942655,25433860,25866879,14514695,26387458,27669037,29625553,32477307