SubtiBank SubtiBank
clpX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

clpX

AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit (class III heat-shock protein)
locus
BSU_28220
pI
4.64
mw
46.25 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
function
protein degradation
product
AAA unfoldase, ATP-dependent Clp protease, ATP-binding subunit
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    2,884,781 2,886,043

    Phenotypes of a mutant

  • increased thermotolerance due to increased stabiliy of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] and thus increased expression of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' [Pubmed|24417481]
  • the mutation suppresses the heat sensitivity of spores overexpressing ''[gene|85DE3CB6CDA61C141C6030367C0A13BB642160B9|cmpA]'' [Pubmed|26387458]
  • The protein

    Catalyzed reaction/ biological activity

  • ATPase/chaperone
  • Protein family

  • ClpX chaperone family (with [protein|2A5A080273CB7698DFABB147F4143E90BBCA3B01|ClpY], according to UniProt)
  • [SW|Domains]

  • AAA-ATPase [http://pfam.sanger.ac.uk/family?acc=PF07724 PFAM]
  • Zinc finger [http://pfam.sanger.ac.uk/family?acc=PF06689 PFAM]
  • Structure

  • [PDB|1UM8] (from ''Helicobacter pylori'') [Pubmed|14514695]
  • [SW|Localization]

  • cytoplasmic polar clusters, excluded from the nucleoid, induced clustering upon heat shock, colocalization with [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP] [Pubmed|18786145,18689473]
  • Expression and Regulation

    Operons

    genes
    [gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]
    description
    [Pubmed|11325926]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8973311], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [Pubmed|9852015], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • induced by heat stress ([protein|search|CtsR]) [Pubmed|9852015]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B019 (clpX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1018 NBRP B. subtilis, Japan]
  • GPUG2 (aphA3), available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs
  • GP1787 (aphA3), available in [SW|Jörg Stülke]'s lab
  • ''clpX::kan'', ''clpX::spec'' and ''clpX::cat'' available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
  • BKE28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC, downstream forward: _UP4_TAAAGATAAGCACAAACCTC
  • BKK28220 ([gene|297F53DAD3351E0C55108DD2C93B78FFB174438C|clpX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTTCACCCCTTAATC, downstream forward: _UP4_TAAAGATAAGCACAAACCTC
  • GFP fusion

  • C-terminal GFP fusions (both single copy and 2th copy in ''amyE'' locus, also as CFP and YFP variants) available from the [http://subtiwiki.uni-goettingen.de/wiki/index.php/Leendert_Hamoen Hamoen]] Lab
  • labs

  • [SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]
  • References

    Reviews

  • 23375660,19680248,17302811,23479438,19609260,26639779,28748186
  • Original Publications

  • 12761164,10809708,9643546,11807061,14679237,18689476,16899079,8973311,19136590,11325926,8973311,9852015,18689473,20525796,15948963,18786145,24417481,24942655,25433860,25866879,14514695,26387458,27669037,29625553,32477307