SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


HPr, General component of the sugar [SW|phosphotransferase system] (PTS)
9.05 kDa
protein length
gene length
267 bp Sequence Blast
PTS-dependent sugar transport and carbon catabolite repression
histidine-containing phosphocarrier protein HPr of the PTS

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|General PTS proteins]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    1,459,384 1,459,650

    The protein

    Protein family

  • HPr family (with [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh], according to UniProt)
  • Paralogous protein(s)

  • [protein|A269774F2FDC94F93BA5F1360FFFE754B50383AD|Crh]
  • [SW|Domains]

  • HPr domain (aa 2-88) (according to UniProt)
  • Modification

  • transient phosphorylation by [protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|Enzyme I] of the PTS on His-15
  • regulatory phosphorylation on Ser-46 by [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] [Pubmed|2507315]
  • an extensive study on ''in vivo'' HPr phosphorylation can be found in Singh et al. (2008) [PubMed|18757537]
  • weak phosphorylation on Ser-12 [Pubmed|17218307]
  • ''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC] on Ser-12 [Pubmed|20389117]
  • Structure

  • [PDB|2HID] (NMR) [Pubmed|9336834]
  • [PDB|1KKM] (complex of ''L. casei'' [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] with ''B. subtilis'' HPr-Ser-P)
  • [PDB|1KKL] (complex of ''Lactobacillus casei'' [protein|771F205F818A755A661B8E1C95365A4F6AEB05C7|HprK] with ''B. subtilis'' HPr)
  • [PDB|3OQM] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the [gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA] operator site)
  • [PDB|3OQN] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and the [gene|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR] operator site)
  • [PDB|3OQO] (complex of ''B. subtilis'' [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA] with P-Ser-[protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr] and a optimal synthetic operator site)
  • [SW|Localization]

  • cytoplasm [Pubmed|16395550]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11902727], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]: antitermination, via the [protein|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT]-dependent [SW|RNA switch] [PubMed|9765562], in [regulon|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|GlcT regulon]
  • regulation

  • expression activated by glucose (2 fold) ([protein|search|GlcT]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • available in [SW|Jörg Stülke]'s lab:
  • MZ303 (cat)
  • GP507 [gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]1 (S46A)
  • GP506 ([gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-H15A)
  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
  • BKE13900 (Δ[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13900 (Δ[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • Expression vectors

  • pGP438 (with N-terminal Strep-tag, in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pAG2 (His-tag) [Pubmed|9237995], available in [SW|Anne Galinier] lab
  • pGP371(expression / purification of HPr-S46A, with His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP1415 (HPr, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • pGP961 (HPr, expression in ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP1416 (HPr-H15A, expression in ''B. subtilis'', from [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • pGP2431 (N-terminal Strep-tag, expression and purification from ''B. subtilis'', in [SW|pGP380]), for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • [SW|Boris Görke], Max Perutz Center, Vienna, Austria
  • [SW|Anne Galinier], University of Marseille, France
  • References

  • 16519689,12850135,17218307,16519689,17142398,12359875,1577686,9162046,11929549,9336834,7803390,7623661,2846556,8169206,9973552,15126459,10048041,12169607,9622354,10217795,17693724,18757537,9202047,7592487,15369672,14527945,2507315,8580838,19651770,8418852,26282429,1303754,1549615,20081037,20389117,20444094,22001508,22722928,23551403,15378759,26381121,9336834