SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


sporulation initiation phosphotransferase of the phosphorelay
22.40 kDa
protein length
192 aa Sequence Blast
gene length
576 bp Sequence Blast
initiation of sporulation
sporulation initiation phosphotransferase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The phosphotransferases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The phosphotransferases]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,853,981 → 2,854,559

    Phenotypes of a mutant

  • Arrest of sporulation at stage 0 (initiation) [ PubMed]
  • The protein


  • [PDB|1F51] (complex with [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]), [PDB|1IXM]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2537815], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is repressed by binding of [SW|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]
  • view in new tab

    Biological materials


  • [ spo0B12], point mutation 85C>T (=R29W), available in [ BGSC] 1S54
  • [ spo0B136], amber mutation 103A>T (=K35X), available in [ BGSC] 1S16
  • [ spo0B580ts], point mutation 193G>A (=E65K), available in [ BGSC] 1S90
  • [ spo0B581ts], point mutation 461G>A (=G154D), available in [ BGSC] 1S91
  • BKE27930 (Δ[gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]::erm trpC2), available at [ BGSC], upstream reverse: _UP1_CATTTTCGCACTCCCAATCA, downstream forward: _UP4_TAGCGGAGTTTTTAACGGTT
  • BKK27930 (Δ[gene|29D91115BB3AC03538D618E54A5A57F92777EFF6|spo0B]::kan trpC2), available at [ BGSC], upstream reverse: _UP1_CATTTTCGCACTCCCAATCA, downstream forward: _UP4_TAGCGGAGTTTTTAACGGTT
  • References

  • 20413551,12730135,2437099,9141138,3918016,9299348,16788205,12067336,9726997,2118512,10997904,1846779,9477965,2537815,23490197,27679485