SubtiBank SubtiBank
purB

purB

adenylsuccinate lyase
locus
BSU_06440
pI
5.82
mw
49.32 kDa
protein length
431 aa Sequence Blast
gene length
1296 bp Sequence Blast
function
purine biosynthesis
product
adenylsuccinate lyase
essential
no
ec
4.3.2.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    Coordinates
    700,232 701,527

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • N6-(1,2-dicarboxyethyl)-AMP --> AMP + fumarate (according to UniProt)
  • (2S)-2-[5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamido]succinate --> 5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide + fumarate (according to UniProt)
  • Protein family

  • [SW|lyase 1 family] (according to UniProt)
  • Structure

  • [PDB|1F1O]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06440 ([gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAGGTCTTGAATAACGTT, downstream forward: _UP4_TAGAAGAAGCTTTTAGCGGC
  • BKK06440 ([gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAGGTCTTGAATAACGTT, downstream forward: _UP4_TAGAAGAAGCTTTTAGCGGC
  • References

  • 1722815,3036807,12923093,15378759,7638212,28189581