SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


adenylsuccinate lyase
49.32 kDa
protein length
431 aa Sequence Blast
gene length
1296 bp Sequence Blast
purine biosynthesis
adenylsuccinate lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • Gene

    700,232 701,527

    Phenotypes of a mutant

  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • N6-(1,2-dicarboxyethyl)-AMP --> AMP + fumarate (according to UniProt)
  • (2S)-2-[5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamido]succinate --> 5-amino-1-(5-phospho-β-D-ribosyl)imidazole-4-carboxamide + fumarate (according to UniProt)
  • Protein family

  • [SW|lyase 1 family] (according to UniProt)
  • Structure

  • [PDB|1F1O]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE06440 ([gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAGGTCTTGAATAACGTT, downstream forward: _UP4_TAGAAGAAGCTTTTAGCGGC
  • BKK06440 ([gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCAGGTCTTGAATAACGTT, downstream forward: _UP4_TAGAAGAAGCTTTTAGCGGC
  • References

  • 1722815,3036807,12923093,15378759,7638212,28189581