SubtiBank SubtiBank
ribH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ribH

riboflavin synthase (beta subunit)
locus
BSU_23250
pI
5.20
mw
16.14 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
riboflavin biosynthesis
product
riboflavin synthase (beta subunit)
essential
no
ec
2.5.1.9
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.2|Biosynthesis/ acquisition of riboflavin/ FAD]
  • Gene

    Coordinates
    2,427,892 2,428,356

    The protein

    Catalyzed reaction/ biological activity

  • (2S)-2-hydroxy-3-oxobutyl phosphate + 5-amino-6-(D-ribitylamino)uracil --> 6,7-dimethyl-8-(1-D-ribityl)lumazine + H+ + 2 H2O + phosphate (according to UniProt)
  • Protein family

  • DMRL synthase family (single member, according to UniProt)
  • Structure

  • [PDB|1ZIS], [PDB|1RVV] (the [protein|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|RibE])3-([protein|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|RibH])60 lumazine synthase/riboflavin synthase complex) [Pubmed|7473709]
  • Expression and Regulation

    Operons

    genes
    [gene|3DFCF7C5FE15C9A3E9E7E4B0DA8E926B85DBD180|ribD]-[gene|4E18BD4B084094EE4FBC8FE2AC95B14581D20C0F|ribE]-[gene|F07B7062C850106A95C15978E36DA500F8B089D6|ribA]-[gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]-[gene|8146A052E4E7844F781E7169C264EC927DEB7387|ribT]
    description
    [Pubmed|8159171]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8159171], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|FMN-box|FMN-box]: transcription termination, via [SW|FMN-box] in the presence of FMN or FMNH2, this is counter-acted upon binding of [protein|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|RibR], in [regulon|FMN-box|FMN-box]
  • regulation

  • expressed in the absence of FMN ([SW|FMN-box]) [Pubmed|15808508]
  • binding of FMN to the [SW|FMN-box] RNA is facilitated by [protein|43CFA3477B4EEB4CE0B2DF63ED2B5EDB171E79C7|NusG]-mediated transcription pausing [pubmed|32817529]
  • the [SW|FMN-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE23250 ([gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATTCCCATCCTTTT, downstream forward: _UP4_TAATTTGCTGAAAACAGTTT
  • BKK23250 ([gene|2A5DCBFAB51996F0DDEC964D5D178274AF86CE69|ribH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGATTCCCATCCTTTT, downstream forward: _UP4_TAATTTGCTGAAAACAGTTT
  • References

    Reviews

  • 11395405
  • Original publications

  • 12456892,15808508,7473709,8159171,7934830,3100522,23270261,24442413,26494285,29087189