SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to alkaline-shock protein
13.05 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,656,064 1,656,426

    The protein

    Protein family

  • asp23 family (with [protein|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|YqhY], according to UniProt)
  • Paralogous protein(s)

  • [protein|FACE7176B1A1F354CF27FB30E46A1140FAFB02F0|YqhY]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B375 (yloU::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1465 (''yloU''-''cat ''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • GP1467 (''yloU''-[gene|5DE73E8005AFFD30EB84696B2C2474899C6D1982|fakA]-''cat ''), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • BKE15830 ([gene|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTAGTTCCTCCTTCGA, downstream forward: _UP4_AACCCGTAGTTAGGAGGAGT
  • BKK15830 ([gene|2AD4F0AA218D4B8864E43A3E501A5B7EFC6256FE|yloU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACTAGTTCCTCCTTCGA, downstream forward: _UP4_AACCCGTAGTTAGGAGGAGT
  • Expression vectors

  • GP1476 (chromosomal ''yloU''-Strep fusion, ''aphA''3), purification from ''B. subtilis'', for [SW|SPINE], available in [SW|Jörg Stülke]'s lab
  • pGP1330 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lab
  • pGP1324 (N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1472 (spc, based on [SW|pBP43]), available in [SW|Jörg Stülke]'s lab [pubmed|28579978]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • References

  • 17114254,22383849,23420519,24178028,28579978