SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to pseudouridylate synthase
31.32 kDa
protein length
283 aa Sequence Blast
gene length
852 bp Sequence Blast
RNA modification
putative pseudouridylate synthase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation/ based on similarity]
  • Gene

    1,238,523 1,239,374

    The protein

    Catalyzed reaction/ biological activity

  • uridine in RNA --> ψ-uridine in RNA (according to UniProt)
  • Protein family

  • [SW|S4 RNA-binding domain] superfamily (according to Interpro)
  • pseudouridine synthase RluA family (with [protein|064AE8CE6D52E35582F90654AA9548963573C05C|YhcT] and [protein|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|YlyB], according to UniProt)
  • Paralogous protein(s)

  • [protein|C8C2E2F1B739F3D9A2FA6B460998708AAB2DA495|YlyB], [protein|064AE8CE6D52E35582F90654AA9548963573C05C|YhcT]
  • [SW|Domains]

  • [SW|S4 RNA-binding domain] (aa 25-79) (according to UniProt)
  • Structure

  • [PDB|1V9F] (RluD from E. coli, 40% identical, aa 64 - 279) [pubmed|15078091]
  • Expression and Regulation




  • expressed during exponential growth
  • view in new tab

    Biological materials


  • MGNA-B161 (yjbO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11620 ([gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGTCCTCAGCGGAAG, downstream forward: _UP4_GAGAATCATTGATTCTCTCC
  • BKK11620 ([gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCGTCCTCAGCGGAAG, downstream forward: _UP4_GAGAATCATTGATTCTCTCC
  • References

  • 18067544,15078091