SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


DNA integrity scanning protein, diadenylate cyclase, delays [SW|sporulation] in the case of chromosome damage, the DisA-dependent checkpoint arrests [SW|DNA replication] during B. subtilis spore outgrowth until the germinating spores genome is free of damage
40.58 kDa
protein length
360 aa Sequence Blast
gene length
1083 bp Sequence Blast
control of [SW|sporulation] initiation
DNA integrity scanning protein, has diadenylate cyclase activity

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW|Other genes]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    107,476 108,558

    Phenotypes of a mutant

  • a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
  • reduced spore survival after infrared exposure [pubmed|28961460]
  • altered morphology on MSgg medium [pubmed|29588402]
  • plant root colonization defect [pubmed|29588402]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
  • binds [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] to inhibit its activity [pubmed|30916351]
  • Protein family

  • DisA family (single member, according to UniProt)
  • [SW|Domains]

  • contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
  • [SW|Cofactors]

  • Mn2+ [pubmed|26014055]
  • Effectors of protein activity

  • [protein|151F226370D225776F3FE7EA4901485095F1AC45|RadA] is an inhibitor of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|DisA] activity [Pubmed|23760274]
  • the presence of potassium results in enhanced activity [pubmed|28420751]
  • Structure

  • [PDB|3C23] [Pubmed|18439896]
  • [SW|Localization]

  • see a [ video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
  • forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
  • forms rapidly moving focus that pausesat [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA]-mediated recombination intermediates upon induction of DNA damage during spore development [pubmed|30916351]
  • additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [pubmed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab



  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    Biological materials


  • MGNA-B932 ([gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2142 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKG2 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::spc''), available in [SW|Jörg Stülke]'s lab
  • 1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [ BGSC]
  • GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
  • BKE00880 ([gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
  • BKK00880 ([gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
  • GP2715 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • GP2752 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP2782 (''Δ''''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''kan''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [ pET19b]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References


  • 22933559,18714086,25869574,23812326,30224435
  • Original publications

  • 24244006,8793870,9987115,16713562,23760274,11544224,17434969,18439896,16713555,12493822,21566650,23192352,23608499,25616256,26014055,27150552,28420751,28511132,28961460,29536659,29588402,30877841,30916351