SubtiBank SubtiBank
disA
The papers of the month are back! Check them out! Link here

disA

DNA integrity scanning protein, diadenylate cyclase, delays [SW|sporulation] in the case of chromosome damage, the DisA-dependent checkpoint arrests [SW|DNA replication] during B. subtilis spore outgrowth until the germinating spores genome is free of damage
locus
BSU00880
pI
5.57
mw
40.58 kDa
protein length
360 aa Sequence Blast
gene length
1080 bp Sequence Blast
function
control of [SW|sporulation] initiation
product
DNA integrity scanning protein, has diadenylate cyclase activity
essential
no
ec
2.7.7.85
synonyms
yacK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    Coordinates
    107,476 → 108,558

    Phenotypes of a mutant

  • a [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] double mutant or [gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA] [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS] [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
  • reduced spore survival after infrared exposure [pubmed|28961460]
  • altered morphology on MSgg medium [pubmed|29588402]
  • plant root colonization defect [pubmed|29588402]
  • The protein

    Catalyzed reaction/ biological activity

  • synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352,21566650]
  • Protein family

  • disA family (according to Swiss-Prot)
  • [SW|Domains]

  • contains a [SW|DAC domain] for the synthesis of c-di-AMP [Pubmed|18439896]
  • [SW|Cofactors]

  • Mn2+ [pubmed|26014055]
  • Effectors of protein activity

  • [protein|151F226370D225776F3FE7EA4901485095F1AC45|RadA] is an inhibitor of [protein|2B091CCEE9E34D659771E39B1FC9050A145048AB|DisA] activity [Pubmed|23760274]
  • the presence of potassium results in enhanced activity [pubmed|28420751]
  • Structure

  • [PDB|3C23] [Pubmed|18439896]
  • [SW|Localization]

  • see a [http://download.cell.com/mmcs/journals/0092-8674/PIIS0092867406005034.mmc12.avi video] showing the movement of DisA in the cell (in real time) [Pubmed|16713562]
  • forms discrete globular foci in germinating spres that colocalize with the nucleoid [Pubmed|24244006]
  • additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [pubmed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|908DB17A39D518E84977250C55825E77FA02E391|ctsR]-[gene|CA0939064E70A97434FA450A69E779FD89880613|mcsA]-[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]-[gene|86A2F2F65290F4471D6FD03B694821C66C180D8A|clpC]-[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|8793870]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    genes
    [gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]
    description
    [Pubmed|17434969]

    regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B932 (yacK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1931 NBRP B. subtilis, Japan]
  • GP2142 (''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • BKG2 (''[gene|151F226370D225776F3FE7EA4901485095F1AC45|radA]-[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::spc''), available in [SW|Jörg Stülke]'s lab
  • 1A939 ( ''disA''::''tet''), [Pubmed|16713562], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A939&Search=1A939 BGSC]
  • GP2222 ([gene|AFE2A9998219162FE32E95628B3CA9071099B61A|cdaA]::cat [gene|92EF98B872C1AD729B0BFAD46D3FA572E9C2AA32|cdaS]::ermC ''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
  • BKE00880 (Δ[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
  • BKK00880 (Δ[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCCTTTTTTCTCTTTTTCCA, downstream forward: _UP4_TGATTTCGGTTAAAACCTTA
  • GP2715 (''[gene|2B091CCEE9E34D659771E39B1FC9050A145048AB|disA]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • Expression vectors

  • IPTG inducible expression of His-''disA'' in ''E. coli'': pGP2563 (in [http://biochem.web.utah.edu/hill/links/pET19b.pdf pET19b]), available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 22933559,18714086,25869574,23812326,30224435
  • Original publications

  • 24244006,8793870,9987115,16713562,23760274,11544224,17434969,18439896,16713555,12493822,21566650,23192352,23608499,25616256,26014055,27150552,28420751,28511132,28961460,29536659,29588402