SubtiBank SubtiBank
ylmG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ylmG

unknown
locus
BSU_15400
pI
8.89
mw
10.17 kDa
protein length
gene length
273 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,611,321 1,611,593

    The protein

    Protein family

  • YggT family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]-[gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]-[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]-[gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]-[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]
    description
    [Pubmed|16420366]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B171 (ylmG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1170 NBRP B. subtilis, Japan]
  • 1A826 ( ''ylmG''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A826&Search=1A826 BGSC]
  • BKE15400 ([gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTTGATAAAGGATCATCT, downstream forward: _UP4_TAATGTGACAGTTTGATAGG
  • BKK15400 ([gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACTTGATAAAGGATCATCT, downstream forward: _UP4_TAATGTGACAGTTTGATAGG
  • References

  • 14651647,16420366