SubtiBank SubtiBank
ywjG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywjG

unknown
locus
BSU_37140
pI
4.32
mw
18.92 kDa
protein length
173 aa Sequence Blast
gene length
522 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,810,090 3,810,611

    The protein

    Structure

  • [PDB|3JX9] (from Exiguobacterium sp., 26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|2B34C65B85D5242B7D97CAF4FBAFFEABB26004E3|ywjG]
    description
    [Pubmed|2457578]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B659 (ywjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1658 NBRP B. subtilis, Japan]
  • BKE37140 ([gene|2B34C65B85D5242B7D97CAF4FBAFFEABB26004E3|ywjG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTGAATCCTCCTTTA, downstream forward: _UP4_TAATATCTTATTGTACATGC
  • BKK37140 ([gene|2B34C65B85D5242B7D97CAF4FBAFFEABB26004E3|ywjG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTGAATCCTCCTTTA, downstream forward: _UP4_TAATATCTTATTGTACATGC
  • References

  • 2457578