SubtiBank SubtiBank
yfhL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfhL

general stress protein, important for survival at low temperature (4C) and during ethanol stress
locus
BSU_08580
pI
11.02
mw
11.86 kDa
protein length
110 aa Sequence Blast
gene length
333 bp Sequence Blast
product
resistence protein (against toxic peptide [protein|820635420B3980B620F3E3D7ACF7EDE9DC6275AD|SdpC])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    929,406 929,738

    The protein

    Paralogous protein(s)

  • [protein|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|YbgB], [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|SdpI]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|893103B8E6163A4B403CA136A92BA3EA66DC3802|yfhK]-[gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]-[gene|ED478E2C37F2AD8BF06251B52511287EDB91C9EE|yfhM]
    description
    [Pubmed|10913081]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10913081,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|10913081,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C364 (yfhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2362 NBRP B. subtilis, Japan]
  • BKE08580 ([gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCATCTCCTTTCT, downstream forward: _UP4_ACGCACAGTCAAGGAGGAGA
  • BKK08580 ([gene|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|yfhL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATCATCTCCTTTCT, downstream forward: _UP4_ACGCACAGTCAAGGAGGAGA
  • References

  • 16629676,10913081,15805528,9987136