SubtiBank SubtiBank
cotSA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cotSA

spore coat protein
locus
BSU_30910
pI
7.81
mw
42.75 kDa
protein length
377 aa Sequence Blast
gene length
1134 bp Sequence Blast
function
resistance of the spore
product
spore coat protein
essential
no
synonyms
ytxN,ytbA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    3,160,761 3,161,894

    The protein

    Protein family

  • [SW|glycosyltransferase 1 family] (according to UniProt)
  • [SW|Glycosyltransferase 4 subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6911DFB27F6A23F3775DAC5C289EFA163FBD1E56|YtcC]
  • Expression and Regulation

    Operons

    genes
    [gene|2C17028E7DC755FFC190397AC6509E383C4DF99A|cotSA]-[gene|DC99E507696A1CB23140A1CBA45DA07D1F7C7D53|cotS]-[gene|5A13CEBB6820454E38DE81C1663078531B2AE4C2|ytxO]
    description
    [Pubmed|9603889]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,9603889], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|15699190,9603889]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A284 (ytfD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/284 NBRP B. subtilis, Japan]
  • BKE30910 ([gene|2C17028E7DC755FFC190397AC6509E383C4DF99A|cotSA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATAGCCTCCATTCCT, downstream forward: _UP4_AACAGATAGAAGGGGTGAAC
  • BKK30910 ([gene|2C17028E7DC755FFC190397AC6509E383C4DF99A|cotSA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACATAGCCTCCATTCCT, downstream forward: _UP4_AACAGATAGAAGGGGTGAAC
  • References

  • 11737650,10234840,15699190,9603889