SubtiBank SubtiBank
yoyE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yoyE

unknown
locus
BSU_19639
pI
10.09
mw
4.70 kDa
protein length
gene length
126 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,136,373 2,136,498

    Expression and Regulation

    Operons

    genes
    [gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|30782632], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [pubmed|22383849]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE19639 ([gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19639 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCACCCCTCCTTCC, downstream forward: _UP4_TAAAACTGCAGAAAACTGCG
  • BKK19639 ([gene|2C216134CB23B7102542C43D25CBEE206145E026|yoyE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19639 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCCACCCCTCCTTCC, downstream forward: _UP4_TAAAACTGCAGAAAACTGCG
  • References

    Research papers

  • 30782632