SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcriptional regulator ([SW|LysR family])
32.08 kDa
protein length
295 aa Sequence Blast
gene length
888 bp Sequence Blast
transcriptional regulator ([SW|LysR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    3,377,893 3,378,780

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|5Y2V] (from Synechocystis PCC6803, 28% identity) [pubmed|29279392]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP1910 (''yusT''::cat), available in [SW|Jörg Stülke]'s lab
  • BKE32920 ([gene|2C2A79E6D77A228D7259C9CA4DCF1C5D89E954F3|yusT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAACTCCTCCGTTC, downstream forward: _UP4_CTATAATGAACAGACTGCTT
  • BKK32920 ([gene|2C2A79E6D77A228D7259C9CA4DCF1C5D89E954F3|yusT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGAACTCCTCCGTTC, downstream forward: _UP4_CTATAATGAACAGACTGCTT
  • References

    Research papers

  • 29279392