SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|phosphorelay] regulator, initiation of [SW|sporulation], coordinates [SW|DNA replication] and initiation of [SW|sporulation] by binding to sites close to the oriC
29.54 kDa
protein length
267 aa Sequence Blast
gene length
801 bp Sequence Blast
initiation of [SW|sporulation]
[SW|phosphorelay] response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The ultimate target]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Regulation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The ultimate target]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    2,518,023 → 2,518,826

    Phenotypes of a mutant

  • inactivation of ''[gene|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]'' restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • altered cell death pattern in colonies [Pubmed|23012477]
  • The protein

    Catalyzed reaction/ biological activity

  • activation of gene expression at the onset of [SW|sporulation] ([SW|Spo0A regulon])
  • coordination between [SW|DNA replication] and initiation of [SW|sporulation] by binding to sites close to the ''oriC'' (this limits re-initiation of replication) [Pubmed|23301687]
  • required for [SW|biofilm formation] [Pubmed|11886552]
  • required for [SW|sliding] [Pubmed|26152584]
  • Modification

  • receives phosphorylation from [protein|29D91115BB3AC03538D618E54A5A57F92777EFF6|Spo0B], dephosphorylation by [protein|A574974B6F4FF46DC69E03AE021651C67089866F|Spo0E], direct phosphorylation by [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] upon potassium leakage [Pubmed|19114652]
  • phosphorylation is enhanced in a [gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho] mutant [pubmed|28723971]
  • Effectors of protein activity

  • the phosphorylation state affects DNA binding activity
  • interaction with [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA] inhibits the transcriptional activity of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]∼P [Pubmed|21435029]
  • transcription activation by [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P is inhibited by interaction with [protein|331993A875907C10C77105FD8DDD86D4412CE405|MecA] (in complex with [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC]) [pubmed|29446505]
  • Structure

  • [PDB|1QMP] (with phosphorylated aspartate, ''Geobacillus stearothermophilus''), [PDB|1FC3] (trans-activation domain, ''Geobacillus stearothermophilus''), [PDB|1LQ1] (complex with DNA)
  • additional information

  • information on binding sites can be found on [ PRODORIC2 database page 1] and [ PRODORIC2 database page 2]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11254139,1569009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11254139,1569009], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|1391039], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expression increases when drowth rate declines [Pubmed|21552330]
  • view in new tab

    Biological materials


  • MGNA-C448 (spo0A::erm), available at the [ NBRP B. subtilis, Japan]
  • BKG9 (''[gene|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • SS995 (''[gene|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]''::''ery'') [Pubmed|14761993]
  • BKE24220 (Δ[gene|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCTTCCTCCCCAAA, downstream forward: _UP4_TAAACATGAGCTTATTAAGT
  • BKK24220 (Δ[gene|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTCTTCCTCCCCAAA, downstream forward: _UP4_TAAACATGAGCTTATTAAGT
  • labs

  • [SW|Tony Wilkinson], York University, U.K. [ homepage]
  • [SW|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [ homepage]
  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 19995980,20030732,20157337,11286862,20833318,20955377,22303284,24914187,26458398,28075389,28886686
  • The [SW|Spo0A regulon]

  • 14651647,15687200
  • Other original Publications

  • 14679239,1569009,20413551,20404177,19528067,19581368,8730857,2106683,3157992,11254139,12067336,10869437,16385044,9287005,8127878,9287022,8231806,1905258,16452424,2118505,8207022,12176382,9733708,11069677,12730135,2437099,8288522,16166384,9495766,2118512,26165942,1556084,18296515,7768874,3145384,19114652,20689749,1537790,9658000,8509330,14762002,1846779,2981817,9477965,8600030,18840696,1391039,14976210,19207565,11679073,12270811,11112444,18978066,20154131,14712656,17157871,15060025,9685500,10852876,21552330,22303282,22745669,23301687,23335417,23660663,25225273,25341802,26152584,23012477,23170957,23169620,22412392,21326214,21435029,21478340,21622736,21949067,21980382,22211522,23927765,24123822,27208661,27216630,27215790,27891124,28033323,28723971,28838935,27501195,29446505,30212463