SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional regulator Spx, involved in regulation of many genes, important for the prevention of protein aggregation during severe heat stress, required for protection against paraquat stress
15.39 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
negative and positive regulator of many genes
transcriptional regulator Spx

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    1,227,697 1,228,092

    Phenotypes of a mutant

  • Loss of up-regulation of the methionine sulfoxide reductase (''[gene|389245FDE13226D65DF117E28B5DA346DC856860|msrA]-[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]'') operon in response to thiol specific oxidative stress, also loss of ''[gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA]'' and ''[gene|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|trxB]'' upregulation in response to thiol specific oxidative stress.
  • The protein

    Catalyzed reaction/ biological activity

  • transcriptional regulator of many genes in response to thiol specific oxidative stress (transcription activator of [gene|4E5C84FDC8FE2FEFF47306C91ECAB7F17D3E38E9|trxA] and [gene|1BC439BBCD5FE19D5780519D7E4317C2EFF0D21B|trxB])
  • in addition, Spx inhibits transcription by binding to the C-terminal domain of the alpha subunit of RNAP ([protein|5996A5C25E108A3C4562686BF34A59CB14FD56EB|RpoA]), disrupting complex formation between RNAP and certain transcriptional activator proteins like [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD] and [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]
  • in response to thiol specific oxidative stress, Spx can also activate transcription, making it a general regulator that exerts both positive and negative control over transcription initiation
  • involved in competence regulation [Pubmed|11703662]
  • inhibits expression of translation-related genes during heat stress [pubmed|30480837]
  • Protein family

  • ArsC family (with [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR] and [protein|5278DD377B110CC14E239B9428F1985B472EEDF5|YusI], according to UniProt)
  • Paralogous protein(s)

  • [protein|6A38DAA96F7BBF31FD8A4018A8CA7A72F3C28F79|MgsR]
  • [SW|Domains]

  • CXXC (10-13): Acts as a disulfide switch for the redox-sensitive transcriptional regulation of genes that function in thiol homeostasis.
  • Modification

  • Cysteine oxidation of CXXC motif
  • phosphorylation on R14, R91, R100, R112 by McsB, dephosphosphorylation by YwlE [pubmed|30962353]
  • Structure

  • [PDB|1Z3E] complex with C-terminal domain of [protein|5996A5C25E108A3C4562686BF34A59CB14FD56EB|RpoA] [pubmed|16249335]
  • [PDB|6GHB] (complexed with oxidized Geobacillus kaustophilus [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|YjbH]) [Pubmed|30982633]
  • [PDB|6GHO] (complexed with Geobacillus kaustophilus [protein|87124945A1CBF7990856FBEB9EAD25096DAC0868|YjbH]) [Pubmed|30982633]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, four promoters upstream of [protein|54D021424B31A8244F0F4B32EF9483CF27F90D43|YjbC], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, four promoters upstream of [protein|54D021424B31A8244F0F4B32EF9483CF27F90D43|YjbC], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, four promoters upstream of [protein|54D021424B31A8244F0F4B32EF9483CF27F90D43|YjbC] [PubMed|10913081], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, four promoters upstream of [protein|54D021424B31A8244F0F4B32EF9483CF27F90D43|YjbC] [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, four promoters upstream of [protein|54D021424B31A8244F0F4B32EF9483CF27F90D43|YjbC], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|17158660], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [PubMed|10913081], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|17158660], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    additional information

  • post-translational control by [protein|297F53DAD3351E0C55108DD2C93B78FFB174438C|ClpX]-[protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]: Spx naturally contains a C-terminal sequence that resembles the [protein|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|SsrA] tag and targets the protein for degradation. [pubmed|12642660]
  • Biological materials


  • MGNA-B151 (yjbD::erm), available at the [ NBRP B. subtilis, Japan]
  • GPUG3 (spc), available in [SW|Ulf Gerth]s and [SW|Jörg Stülke]'s labs
  • GP1788 (spc), available in [SW|Jörg Stülke]'s lab
  • ORB6781 (spc), ORB6876 (tet), available in [SW|Zuber] lab, also available in [SW|Jörg Stülke]'s lab
  • 1A917 ( ''spx''::''spec''), [Pubmed|21949854], available at [ BGSC]
  • 1A916 ( ''spx''::''tet''), [Pubmed|21949854], available at [ BGSC]
  • BKE11500 ([gene|2C6386E9A63F410558D168798D077DF91590F454|spx]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATCTTCACTCCTCTA, downstream forward: _UP4_TAATAGATCGTATCATCAAA
  • BKK11500 ([gene|2C6386E9A63F410558D168798D077DF91590F454|spx]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATCTTCACTCCTCTA, downstream forward: _UP4_TAATAGATCGTATCATCAAA
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Peter Zuber], Oregon Health and Science University, USA, [ Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [ Homepage]
  • References


  • 19575568,20626317,30830258,31655740
  • The [SW|Spx regulon]

  • 15937167,14597697,15028674,22904090,29271514
  • Structural analysis of Spx

  • 19580872,16249335,23813734
  • Original Publications

  • 21378193,22307755,18487332,17908206,17434969,17158660,19074380,15805528,18662407,16885442,18179421,17434969,17908206,17158660,11703662,15659166,12642660,12057962,10482513,18687074,12775685,16740936,17827297,20084284,20057163,10913081,21815947,23894131,23934352,22582280,24417481,24942655,25353645,25433860,27191337,28484046,30001325,30480837,30718304,30982633,30962353