SubtiBank SubtiBank
ypjQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypjQ

similar to low temperature requirement C protein
locus
BSU_21830
pI
4.50
mw
19.76 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,297,984 2,298,517

    The protein

    Paralogous protein(s)

  • [protein|644638C7B9CA839714E086AF604BD7D2853C7E95|YutG]
  • Structure

  • [PDB|1TLQ]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8B515C789439354F870023E69077D2C1D709E046|ypjP]-[gene|2CB3BAF17F59A858D249619A436EF660CAA58DD5|ypjQ]-[gene|9F9643D51E9ABA537892B19312491697CECDDCCF|thyB]-[gene|B740E971204AC14BA456B8C93A86D4BDC29524FF|dfrA]-[gene|9D1DAA5E69DD12FDE0FB33EA0863E0CB214120EC|ypkP]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|8B515C789439354F870023E69077D2C1D709E046|ypjP]-[gene|2CB3BAF17F59A858D249619A436EF660CAA58DD5|ypjQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A881 (ypjQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/881 NBRP B. subtilis, Japan]
  • BKE21830 ([gene|2CB3BAF17F59A858D249619A436EF660CAA58DD5|ypjQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTCTAATGGCATCT, downstream forward: _UP4_TGACTATAAAAAAATCATTT
  • BKK21830 ([gene|2CB3BAF17F59A858D249619A436EF660CAA58DD5|ypjQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATGTCTAATGGCATCT, downstream forward: _UP4_TGACTATAAAAAAATCATTT