SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to GTP-binding elongation factor
68.21 kDa
protein length
612 aa Sequence Blast
gene length
1839 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • Gene

    1,546,121 1,547,959

    The protein

    Catalyzed reaction/ biological activity

  • in E. coli, the corresponding protein (BipA) incorporates ribosomal protein [protein|20485A785D3AF82889F2018D3EA5B5FA33E64E95|L6] into the nascent large ribosomal subunit [pubmed|30305394]
  • Protein family

  • [SW|TRAFAC class translation factor GTPase superfamily] (according to UniProt)
  • [SW|Classic translation factor GTPase family] (according to UniProt)
  • [SW|Domains]

  • [SW|tr-type G domain] (aa 5-200) (according to UniProt)
  • Structure

  • [PDB|4ZCM] (from E. coli, 55% identity) [pubmed|26163516]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • view in new tab

    Biological materials


  • MGNA-A536 (ylaG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14770 ([gene|2D0A95A37214E9BF58E2DE732DE9F32AAF9C1CD3|ylaG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTCATCTCCTAAAA, downstream forward: _UP4_TAATCTCGTGCAGAATTTGA
  • BKK14770 ([gene|2D0A95A37214E9BF58E2DE732DE9F32AAF9C1CD3|ylaG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTTTCATCTCCTAAAA, downstream forward: _UP4_TAATCTCGTGCAGAATTTGA
  • References

  • 11948165,12399512,30305394,26163516