SubtiBank SubtiBank
ytcQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytcQ

polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (solute-binding lipoprotein)
locus
BSU_30160
pI
4.96
mw
55.14 kDa
protein length
498 aa Sequence Blast
gene length
1497 bp Sequence Blast
function
uptake of polygalacturonan and rhamnogalacturonan
product
polygalacturonan and rhamnogalacturonan [SW|ABC transporter] (solute-binding lipoprotein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.26|Utilization of pectin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,085,800 3,087,296

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|A4DA5C00BA37FF65E4190EC95B183ABAF1C9364D|LplA]
  • [SW|Localization]

  • associated to the membrane (via [protein|87B212C8C61483DF2874762A3B77111616C616A5|YtcP]-[protein|4ED1DD17694A06CFDFF48943BAE8AEC2CCCB0401|YteP]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|87B212C8C61483DF2874762A3B77111616C616A5|ytcP]-[gene|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A806 (ytcQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/806 NBRP B. subtilis, Japan]
  • BKE30160 ([gene|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTACCCCTCCGTTTCA, downstream forward: _UP4_TAACATTGGAAAAACCCAAA
  • BKK30160 ([gene|2D46E89AF6157B49BD443F47DB4A7258F22E8A24|ytcQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTACCCCTCCGTTTCA, downstream forward: _UP4_TAACATTGGAAAAACCCAAA
  • References

  • 10092453,22383849,29240795