SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


D-Tyr resistance regulator ([SW|MarR family])
19.50 kDa
protein length
171 aa Sequence Blast
gene length
516 bp Sequence Blast
resistance to D-Tyr
transcription factor ([SW|MarR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    3,946,394 3,946,909

    The protein

    Catalyzed reaction/ biological activity

  • repression of the ''[gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]-[gene|1968743631A20739B5DA8B489CB1E7E42F3B93E3|tyrZ]'' operon [Pubmed|25733610]
  • Protein family

  • [SW|MarR family]
  • Structure

  • [PDB|3CDH] (from Silicibacter pomeroyi, 24% identity)
  • Expression and Regulation



    sigma factors

  • [protein|1968743631A20739B5DA8B489CB1E7E42F3B93E3|TyrZ]: sigma factor, [Pubmed|1735721], in [regulon|1968743631A20739B5DA8B489CB1E7E42F3B93E3|TyrZ regulon]
  • regulatory mechanism

  • [protein|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|DtrR]: repression, [Pubmed|25733610], in [regulon|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|DtrR regulon]
  • [regulon|T-box|T-box]: anti-termination, in [regulon|T-box|T-box]
  • regulation

  • induced by tyrosine limitation ([protein|search|T-box]) [Pubmed|25733610,19258532,1735721]
  • view in new tab

    Biological materials


  • MGNA-B219 (ywaE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38450 ([gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTAGGCCTGCCTTA, downstream forward: _UP4_GCTGACAATCTTCATACAAC
  • BKK38450 ([gene|2D4E3D6C3634C3F42A4517D5C1A8F4F48CAFF3A6|dtrR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTAGGCCTGCCTTA, downstream forward: _UP4_GCTGACAATCTTCATACAAC
  • References

  • 25733610