SubtiBank SubtiBank
yjdF
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yjdF

unknown
locus
BSU_12030
pI
10.56
mw
18.68 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,275,809 1,276,291

    Expression and Regulation

    Operons

    genes
    [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]
    description
    [Pubmed|20139185]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20139185], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|F273002AF97D87BB025B4F014C328C5592EAD621|ManR]: activation, in the presence of mannose and absence of glucose [Pubmed|20139185], in [regulon|F273002AF97D87BB025B4F014C328C5592EAD621|ManR regulon]
  • [regulon|RNA switch|RNA switch]: termination/antitermination, expession may be controlled by a potential [SW|RNA switch] located in the 5' untranslated region of the [gene|575CEC5C5C0458DC86A74F24654AC6990CB1E732|manP]-[gene|E26C70893C5D677C816C814558CC42F90B920087|manA]-[gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF] mRNA between [gene|E26C70893C5D677C816C814558CC42F90B920087|manA] and [gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF], in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by mannose ([protein|search|ManR]) [Pubmed|20139185]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A268 (yjdF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/268 NBRP B. subtilis, Japan]
  • BKE12030 ([gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCAATCATGCATCCG, downstream forward: _UP4_TAATCCAAACAAAAGCAGGC
  • BKK12030 ([gene|2DB0F763349D34FB1FCBBB4665416E129AD0AE6A|yjdF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCAATCATGCATCCG, downstream forward: _UP4_TAATCCAAACAAAAGCAGGC
  • References

  • 20139185,20230605,29223402,26843526