SubtiBank SubtiBank
nasA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nasA

nitrate transporter
locus
BSU_03330
pI
10.49
mw
45.91 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
function
nitrate uptake
product
nitrate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.1|Utilization of nitrate/ nitrite]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    362,937 364,142

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Nitrate/nitrite porter (TC 2.A.1.8) family (with [protein|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|NarK], according to UniProt)
  • Paralogous protein(s)

  • [protein|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|NarK]
  • Structure

  • [PDB|4U4T] (NarK from E. coli, 24% identity) [pubmed|25959928]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]) [Pubmed|8799114]
  • view in new tab

    Biological materials

    Mutant

  • 1A972 ( ''nasA''::''phleo''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A972&Search=1A972 BGSC]
  • BKE03330 ([gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCCCCTTTCTAG, downstream forward: _UP4_TAGGATTTTGACGGACACGC
  • BKK03330 ([gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCCCCTTTCTAG, downstream forward: _UP4_TAGGATTTTGACGGACACGC
  • References

    Reviews

  • 22103536,11289299
  • Original publications

  • 7836289,12823818,25755103,8799114,7868621,25959928