SubtiBank SubtiBank
nasA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

nasA

nitrate transporter
locus
BSU_03330
pI
10.49
mw
45.91 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
function
nitrate uptake
product
nitrate transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.8|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.1|Utilization of nitrate/ nitrite]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    362,937 364,142

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Nitrate/nitrite porter (TC 2.A.1.8) family (with [protein|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|NarK], according to UniProt)
  • Paralogous protein(s)

  • [protein|F14481DAA196868ACC1DE9EC8CBE593A2CBB6BE4|NarK]
  • Structure

  • [PDB|4U4T] (NarK from E. coli, 24% identity) [pubmed|25959928]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]) [Pubmed|8799114]
  • view in new tab

    Biological materials

    Mutant

  • 1A972 ( ''nasA''::''phleo''), [Pubmed|7868621], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A972&Search=1A972 BGSC]
  • BKE03330 ([gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCCCCTTTCTAG, downstream forward: _UP4_TAGGATTTTGACGGACACGC
  • BKK03330 ([gene|2DE7BEC614129384779F4C761E0792385DECC563|nasA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGATTCCCCTTTCTAG, downstream forward: _UP4_TAGGATTTTGACGGACACGC
  • References

    Reviews

  • 22103536,11289299
  • Original publications

  • 7836289,12823818,25755103,8799114,7868621,25959928