SubtiBank SubtiBank
ybgB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybgB

putative immunity protein
locus
BSU_02380
pI
8.47
mw
10.14 kDa
protein length
gene length
276 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    258,532 258,807

    The protein

    Paralogous protein(s)

  • [protein|3FB5839A7A80CF52E627FF1744E50490F5CC390F|SdpI], [protein|2B7F65B145005A8ADD2A278E3EA5A52DF162C837|YfhL]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
    description
    [Pubmed|12897008]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|gamR]) [Pubmed|24673833,23667565]
  • view in new tab

    genes
    [gene|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|gamR]-[gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]
    description
    [Pubmed|23667565]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR]: repression, [Pubmed|24673833,23667565], in [regulon|FB074E8CFCA1C0198457170A7AFD85C875B34DF2|GamR regulon]
  • regulation

  • induced by glucosamine ([protein|search|gamR]) [Pubmed|24673833,23667565]
  • induced by glucosamine ([protein|search|GamR]) [Pubmed|24673833,23667565]
  • view in new tab

    Biological materials

    Mutant

  • BKE02380 ([gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCACCATTCCCTT, downstream forward: _UP4_TAAATCAAACAGCCAGAATA
  • BKK02380 ([gene|2E0FBCA66FB88EDFD345FA289F776C7CA23976F5|ybgB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGAACCACCATTCCCTT, downstream forward: _UP4_TAAATCAAACAGCCAGAATA
  • References

  • 12897008,24673833,23667565