SubtiBank SubtiBank
yheN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yheN

putative polysaccharide deacetylase
locus
BSU_09660
pI
8.61
mw
31.58 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,040,861 1,041,709

    The protein

    Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|603E226CE488A25C4E28A6A7363CCD65BE64BB21|PdaC]:
  • [SW|Domains]

  • NodB homology domain (aa 85-271) (according to UniProt)
  • Structure

  • [PDB|2C1G] (the NodB domain, from Streptococcus pneumoniae, 37% identity) [pubmed|16221761]
  • Expression and Regulation

    Operons

    genes
    [gene|2E2D21BEA164C7EB93B6A3F3C990ABD475920A81|yheN]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A708 (yheN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/708 NBRP B. subtilis, Japan]
  • BKE09660 ([gene|2E2D21BEA164C7EB93B6A3F3C990ABD475920A81|yheN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAATCTCTCCATTGG, downstream forward: _UP4_TAAAAAAGTGAGGCGCATAA
  • BKK09660 ([gene|2E2D21BEA164C7EB93B6A3F3C990ABD475920A81|yheN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAATCTCTCCATTGG, downstream forward: _UP4_TAAAAAAGTGAGGCGCATAA
  • References

    Research papers

  • 16221761