SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional repressor of class I heat-shock genes
38.87 kDa
protein length
343 aa Sequence Blast
gene length
1032 bp Sequence Blast
regulation of chaperone gene expression
transcriptional repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,628,606 2,629,637

    The protein

    Catalyzed reaction/ biological activity

  • transcription repressor of the ''[gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]-[gene|ECAB685E9038DC03FA2CC659112BB07D30DE5C8C|grpE]-[gene|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|dnaK]-[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]-[gene|70D717806F5174447E01FF33DC8299CB025888CD|yqeT]-[gene|F8DC71B29D9C9BF4CF5124D0F01A71548306B9F9|yqeU]-[gene|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|yqeV]'' and ''[gene|0D8B3F1F86FDBAE0F3B3651F456340F147B394AF|groES]-[gene|8F3DEE8828CA6BAAAF6DB2DA4349EF7AA9DF89F8|groEL]'' operons (at low/ normal temperatures)
  • Protein family

  • hrcA family (single member, according to UniProt)
  • Modification

  • phosphorylated on arginine residues [Pubmed|24263382]
  • [SW|Cofactors]

  • [protein|8F3DEE8828CA6BAAAF6DB2DA4349EF7AA9DF89F8|GroEL] acts as co-repressor
  • Structure

  • [PDB|1STZ] (from Thermotoga maritima, 27% identity) [pubmed|15979091]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials


  • BKE25490 ([gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACCTCTGTTA, downstream forward: _UP4_TAAGGGAATTTTGGCAAATT
  • BKK25490 ([gene|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|hrcA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCATCACCTCTGTTA, downstream forward: _UP4_TAAGGGAATTTTGGCAAATT
  • labs

  • [SW|Wolfgang Schumann], Bayreuth University, Germany [ Homepage]
  • [SW|Thomas Wiegert], University of Bayreuth, Germany [ Wiegert-Dateien/Thomas Wiegert.html Homepage]
  • References


  • 27518094,28402413
  • Original Publications

  • 8113175,9023197,9303302,10383760,8576042,12799007,11717291,12082092,1339421,7540247,1339421,9303302,7592421,24263382,15979091