SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


uricase, urate oxidase
56.39 kDa
protein length
494 aa Sequence Blast
gene length
1485 bp Sequence Blast
purine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,333,162 3,334,646

    The protein

    Catalyzed reaction/ biological activity

  • 5-hydroxy-2-oxo-4-ureido-2,5-dihydro-1H-imidazole-5-carboxylate + H+ --> (S)-allantoin + CO2 (according to UniProt)
  • H2O + O2 + urate --> 5-hydroxyisourate + H2O2 (according to UniProt)
  • Protein family

  • N-terminal part: OHCU decarboxylase family (single member, according to UniProt)
  • C-terminal part: uricase family (single member, according to UniProt)
  • Structure

  • [PDB|6A4M]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab


    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A937 (yunL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32450 ([gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGAACATTGGCATCT, downstream forward: _UP4_AAATGTCGGAGCCTGAAAGC
  • BKK32450 ([gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGAACATTGGCATCT, downstream forward: _UP4_AAATGTCGGAGCCTGAAAGC
  • References

  • 11344136,25755103,12823818,12029039,20168977,28531234