SubtiBank SubtiBank
pucL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucL

uricase, urate oxidase
locus
BSU_32450
pI
5.48
mw
56.39 kDa
protein length
494 aa Sequence Blast
gene length
1485 bp Sequence Blast
function
purine utilization
product
uricase
essential
no
ec
1.7.3.3
synonyms
yunL

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,333,162 3,334,646

    The protein

    Catalyzed reaction/ biological activity

  • 5-hydroxy-2-oxo-4-ureido-2,5-dihydro-1H-imidazole-5-carboxylate + H+ --> (S)-allantoin + CO2 (according to UniProt)
  • H2O + O2 + urate --> 5-hydroxyisourate + H2O2 (according to UniProt)
  • Protein family

  • N-terminal part: OHCU decarboxylase family (single member, according to UniProt)
  • C-terminal part: uricase family (single member, according to UniProt)
  • Structure

  • [PDB|6A4M]
  • Expression and Regulation

    Operons

    genes
    [gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12029039]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|52C1601482C26400A524E880334BB801F832D6ED|pucR]-[gene|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|pucJ]-[gene|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|pucK]-[gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]-[gene|A2F93FFE225DFDBCBB3EA079BEF84C79465F0E5C|pucM]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A937 (yunL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/937 NBRP B. subtilis, Japan]
  • BKE32450 ([gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGAACATTGGCATCT, downstream forward: _UP4_AAATGTCGGAGCCTGAAAGC
  • BKK32450 ([gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGAACATTGGCATCT, downstream forward: _UP4_AAATGTCGGAGCCTGAAAGC
  • References

  • 11344136,25755103,12823818,12029039,20168977,28531234