SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


uricase, urate oxidase
56.39 kDa
protein length
494 aa Sequence Blast
gene length
1485 bp Sequence Blast
purine utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,333,162 3,334,646

    The protein

    Catalyzed reaction/ biological activity

  • 5-hydroxy-2-oxo-4-ureido-2,5-dihydro-1H-imidazole-5-carboxylate + H+ --> (S)-allantoin + CO2 (according to UniProt)
  • H2O + O2 + urate --> 5-hydroxyisourate + H2O2 (according to UniProt)
  • Protein family

  • N-terminal part: OHCU decarboxylase family (single member, according to UniProt)
  • C-terminal part: uricase family (single member, according to UniProt)
  • Structure

  • [PDB|6A4M]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab


    regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: auto-repression, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|25755103], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials


  • MGNA-A937 (yunL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32450 ([gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGAACATTGGCATCT, downstream forward: _UP4_AAATGTCGGAGCCTGAAAGC
  • BKK32450 ([gene|2E7DEC53A130247E66225E87950D702E462C324F|pucL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGAACATTGGCATCT, downstream forward: _UP4_AAATGTCGGAGCCTGAAAGC
  • References

  • 11344136,25755103,12823818,12029039,20168977,28531234