SubtiBank SubtiBank
gutB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gutB

D-sorbitol dehydrogenase
locus
BSU_06150
pI
5.21
mw
38.23 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
function
glucitol utilization
product
D-sorbitol dehydrogenase
essential
no
ec
1.1.1.14
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.11|Utilization of glucitol]
  • Gene

    Coordinates
    667,466 668,527

    The protein

    Catalyzed reaction/ biological activity

  • D-fructose + H+ + NADH --> D-sorbitol + NAD+ (according to UniProt)
  • NAD+ + xylitol --> D-xylulose + H+ + NADH (according to UniProt)
  • L-iditol + NAD+ --> H+ + L-sorbose + NADH (according to UniProt)
  • Protein family

  • [SW|zinc-containing alcohol dehydrogenase family] (according to UniProt)
  • [SW|Cofactors]

  • NAD+ (according to UniProt)
  • Structure

  • [PDB|1PL7] (the human enzyme, 42% identity) [pubmed|12962626]
  • Expression and Regulation

    Operons

    genes
    [gene|2E9D10B0FA5685800007222A5AAD71E975675DB1|gutB]-[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]-[gene|0C4F0C9EF18FB4E9BB5BC3F53F7DDF5F32B51FA5|fruC]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8195086], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]: activation, [Pubmed|8195086], in [regulon|926BCA197F259558F72FDCC73998497B9B167D22|GutR regulon]
  • regulation

  • induced by glucitol ([protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]) [Pubmed|8195086]
  • view in new tab

    Biological materials

    Mutant

  • BKE06150 ([gene|2E9D10B0FA5685800007222A5AAD71E975675DB1|gutB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCAAGTTCCTTTCT, downstream forward: _UP4_TGAGTGAACAGGGAGGATCT
  • BKK06150 ([gene|2E9D10B0FA5685800007222A5AAD71E975675DB1|gutB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGCAAGTTCCTTTCT, downstream forward: _UP4_TGAGTGAACAGGGAGGATCT
  • References

  • 1460002,12897001,8195086,12962626