SubtiBank SubtiBank
lgt
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lgt

prolipoprotein diacylglyceryl transferase
locus
BSU34990
pI
8.96
mw
30.47 kDa
protein length
269 aa Sequence Blast
gene length
807 bp Sequence Blast
function
lipomodification of lipoproteins
product
prolipoprotein diacylglyceryl transferase
essential
no
ec
2.4.99.-
synonyms
gerF,yvoC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,593,419 → 3,594,228

    Phenotypes of a mutant

  • reduced ability of spores to germinate with alanine due ti reduced activity of the [protein|EEDE6A22E91992ABCA677CAB7917B7168C5CB868|GerAA]-[protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|GerAB]-[protein|D937E26DF69D49B1341B37596AC6A8FBEEF8BA2E|GerAC] germinant receptor [Pubmed|15126458]
  • inactivation of ''[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]'' reduces sporulation efficiency to 7.7% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • lgt family (according to Swiss-Prot)
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|771F205F818A755A661B8E1C95365A4F6AEB05C7|hprK]-[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF]
    description
    [Pubmed|9465101]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A388 (lgt::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/388 NBRP B. subtilis, Japan]
  • GP851 (Δ([gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]-[gene|FA32AD908196BDA5C2C7C26EA08FB8416182CC3D|yvoD]-[gene|F3970DC380899E0505E80EB327AE27AFDE0F166F|yvoE]-[gene|C6B0EF2CD33D0F5455726167AE8F510619C3F6CA|yvoF])::aphA3), available in [SW|Jörg Stülke]'s lab
  • 1G22 ( ''lgt''::''erm''), [Pubmed|15126458], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1G22&Search=1G22 BGSC]
  • BKE34990 (Δ[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTCATTCATTTAACGCC, downstream forward: _UP4_TAGACGTCAACAAAGGGGGA
  • BKK34990 (Δ[gene|2EB790AD1872ABCB57B784296C04C773AEA9C22B|lgt]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTCATTCATTTAACGCC, downstream forward: _UP4_TAGACGTCAACAAAGGGGGA
  • References

    Reviews

  • 21663440
  • Original publications

  • 9882689,10096076,15126458,18763711,9465101,22493018,9846746,26735940
  • Lgt in other organisms

  • 22287519