SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


65.01 kDa
protein length
561 aa Sequence Blast
gene length
1686 bp Sequence Blast
trehalose utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of trehalose]
  • Gene

    851,850 853,535

    The protein

    Catalyzed reaction/ biological activity

  • α,α-trehalose 6-phosphate + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|MalL], [protein|A641BA91317CBCFE34A2BE69007247F209075095|YcdG], [protein|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|YugT]
  • Structure

  • [PDB|5BRQ] (from B. licheniformis, 73% identity) [pubmed|26894535]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8755887], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR]: repression, [Pubmed|8755887], in [regulon|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18977770], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials


  • MGNA-C260 (treA::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1118 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE07810 ([gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCCACCACCATA, downstream forward: _UP4_TAAACTAAGCTGGGTGGTCC
  • BKK07810 ([gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCCACCACCATA, downstream forward: _UP4_TAAACTAAGCTGGGTGGTCC
  • References

  • 8755887,7651129,7751281,8917076,18977770,26894535