SubtiBank SubtiBank
treA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

treA

phospho-alpha-glucosidase
locus
BSU_07810
pI
4.89
mw
65.01 kDa
protein length
561 aa Sequence Blast
gene length
1686 bp Sequence Blast
function
trehalose utilization
product
phospho-alpha-glucosidase
essential
no
ec
3.2.1.93
synonyms
treC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.20|Utilization of trehalose]
  • Gene

    Coordinates
    851,850 853,535

    The protein

    Catalyzed reaction/ biological activity

  • α,α-trehalose 6-phosphate + H2O --> D-glucose + D-glucose 6-phosphate (according to UniProt)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6E5AB4620F9A896C32CD77AF314C67035814AE0A|MalL], [protein|A641BA91317CBCFE34A2BE69007247F209075095|YcdG], [protein|A9500B1E45CCE51F4A699E4A7BC1F6B272A25A86|YugT]
  • Structure

  • [PDB|5BRQ] (from B. licheniformis, 73% identity) [pubmed|26894535]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]-[gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]-[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]
    description
    [Pubmed|8755887]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8755887], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR]: repression, [Pubmed|8755887], in [regulon|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18977770], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C260 (treA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2258 NBRP B. subtilis, Japan]
  • GP1118 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE07810 ([gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCCACCACCATA, downstream forward: _UP4_TAAACTAAGCTGGGTGGTCC
  • BKK07810 ([gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTTTCCACCACCATA, downstream forward: _UP4_TAAACTAAGCTGGGTGGTCC
  • References

  • 8755887,7651129,7751281,8917076,18977770,26894535