SubtiBank SubtiBank
acoL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

acoL

acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)
locus
BSU_08090
pI
5.27
mw
48.69 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
function
acetoin utilization
product
acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)
essential
no
ec
1.8.1.4
synonyms
yfjH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.2|Utilization of acetoin]
  • Gene

    Coordinates
    882,266 883,642

    The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(dihydrolipoyl)lysine + NAD+ --> protein N6-(lipoyl)lysine + NADH (according to UniProt)
  • Protein family

  • class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|PdhD] and [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|LpdV], according to UniProt)
  • Paralogous protein(s)

  • [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|PdhD], [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|LpdV]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2EQ7] (from Thermus thermophilus, 40% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B0A333BDFAE816B48B856A1DD91B73C41584A8E4|acoA]-[gene|5F953C3C91EB65A031D04A1D91F1CF501F8EFD09|acoB]-[gene|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|acoC]-[gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]
    description
    [pubmed|11274109]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [PubMed|11274109], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-containing [SW|RNA polymerase]) [ PubMed|11274109], in [regulon|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: indirect positive regulation, in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]) [http://www.ncbi.nlm.nih.gov/sites/entrez/11274109 PubMed]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • MGNA-C351 (acoL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2349 NBRP B. subtilis, Japan]
  • BKE08090 ([gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTTTTCACCTGCTT, downstream forward: _UP4_TAATAAAGGAAAAAGCAGGC
  • BKK08090 ([gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTTTTCACCTGCTT, downstream forward: _UP4_TAATAAAGGAAAAAGCAGGC
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [http://www.pasteur.fr/ip/easysite/go/03b-00000m-0ob/recherche/departements-scientifiques/microbiologie/unites-et-groupes/unite-de-biologie-des-bacteries-pathogenes-a-gram-positif/les-membres-de-l-equipe Homepage]
  • References

  • 11274109,10368162,10666464,16428414,12884008,21815947