SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)
48.69 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
acetoin utilization
acetoin dehydrogenase E3 component (dihydrolipoamide dehydrogenase)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of acetoin]
  • Gene

    882,266 883,642

    The protein

    Catalyzed reaction/ biological activity

  • Protein N6-(dihydrolipoyl)lysine + NAD+ --> protein N6-(lipoyl)lysine + NADH (according to UniProt)
  • Protein family

  • class-I pyridine nucleotide-disulfide oxidoreductase family (with [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|PdhD] and [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|LpdV], according to UniProt)
  • Paralogous protein(s)

  • [protein|E9BBAE86DF3E536A987179CC394B472F6F710498|PdhD], [protein|1FD06CB6E81C920EFC656DBE2A13D68B1AA68872|LpdV]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2EQ7] (from Thermus thermophilus, 40% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [PubMed|11274109], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]: activation, (interaction with [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-containing [SW|RNA polymerase]) [ PubMed|11274109], in [regulon|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR regulon]
  • [protein|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr]: indirect positive regulation, in [regulon|7165CC59CDAF64AAE2D591936860304A53BE5DF6|Fnr regulon]
  • regulation

  • induced by acetoin ([protein|706864AAF36684AD5E46F30E9EB76315AB412700|AcoR]) [ PubMed]
  • expression of the operon is strongly induced during [SW|biofilm formation] [pubmed|31113899]
  • additional information

  • the mRNA is substantially stabilized upon depletion of [gene|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|21815947]
  • view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials


  • MGNA-C351 (acoL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08090 ([gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTTTTCACCTGCTT, downstream forward: _UP4_TAATAAAGGAAAAAGCAGGC
  • BKK08090 ([gene|2ECF05AEE1549861EB3AE62139F0E9DEE0B0F632|acoL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGTTTTCACCTGCTT, downstream forward: _UP4_TAATAAAGGAAAAAGCAGGC
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References

  • 11274109,10368162,10666464,16428414,12884008,21815947