SubtiBank SubtiBank
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website


pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit)
47.38 kDa
protein length
442 aa Sequence Blast
gene length
1329 bp Sequence Blast
links glycolysis and TCA cycle
pyruvate dehydrogenase (dihydrolipoamide acetyltransferase E2 subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,530,537 1,531,865

    Phenotypes of a mutant

  • defects in sporulation and unable to grow on glucose as single carbon source [Pubmed|11976308]
  • poor growth [pubmed|28189581]
  • non-transformable [pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • (R)-N6-dihydrolipoyl-L-lysyl-[protein] + acetyl-CoA --> (R)-N6-(S8-acetyldihydrolipoyl)-L-lysyl-[protein] + CoA (according to UniProt)
  • Protein family

  • [SW|2-oxoacid dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC], [protein|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|OdhB], [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB]
  • Kinetic information

  • Michaelis-Menten [Pubmed|6414463]
  • [SW|Domains]

  • [SW|Lipoyl-binding domain] (aa 2-77) (according to UniProt)
  • [SW|Peripheral subunit-binding domain] (PSBD) (aa 141-178) (according to UniProt)
  • Modification

  • phosphorylated (Ser/Thr/Tyr) [Pubmed|17726680]
  • [SW|Cofactors]

  • lipoic acid (on Lys-43), can probably be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN] [pubmed|28900027]
  • Effectors of protein activity

  • Inhibited by thiamine 2-thiothiazolone diphosphate and NADH [Pubmed|6414463]
  • Low sensibility to NADPH
  • Structure

  • [PDB|1W88] (E1 in complex with subunit binding domain of E2, ''Geobacillus stearothermophilus''), [PDB|2PDE] (peripheral subunit binding domain, ''Geobacillus stearothermophilus''), [PDB|1LAC] (lipoyl domain, ''Geobacillus stearothermophilus''), [PDB|1B5S] (catalytic domain (residues 184-425) , ''Geobacillus stearothermophilus'')
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20081037], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, due to presence of guanine at 1 position of the transcript [Pubmed|20081037], in [regulon|stringent response|stringent response]
  • regulation

  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab



  • ''[protein|search|pdhA]'': expression activated by glucose (1.9-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE14600 ([gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTCTCGACCTCCTAG, downstream forward: _UP4_TTAATTTTAATGGAGGCGTA
  • BKK14600 ([gene|2F40086E35FA32136B9A89C530A86D714FE9460C|pdhC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTTCTCGACCTCCTAG, downstream forward: _UP4_TTAATTTTAATGGAGGCGTA
  • labs

  • [SW|Arthur Aronson], Purdue University, West Lafayette, USA [ homepage]
  • References


  • 19476487,9655937,2227213,6805383,1794583,24798336,27074917
  • Original publications

  • 9352926,24825009,9352926,17726680,12850135,18763711,6414463,11976308,20081037,22862776,15378759,28900027,28189581,31066113