SubtiBank SubtiBank
mmgF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mmgF

methylisocitrate lyase
locus
BSU_24120
pI
5.28
mw
32.94 kDa
protein length
301 aa Sequence Blast
gene length
906 bp Sequence Blast
function
mother cell metabolism
product
methylisocitrate lyase
essential
no
ec
4.1.3.30
synonyms
yqiQ,prpB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    2,507,298 2,508,203

    The protein

    Catalyzed reaction/ biological activity

  • 2-methyl-isocitrate --> pyruvate + succinate [pubmed|28956599]
  • 3-hydroxybutane-1,2,3-tricarboxylate --> pyruvate + succinate (according to UniProt)
  • Protein family

  • isocitrate lyase/PEP mutase superfamily (single member, according to UniProt)
  • Structure

  • [PDB|1MUM] (enzyme of ''E. coli''), [PDB|3KZ2] (the enzyme from ''B. anthracis'')
  • Expression and Regulation

    Operons

    genes
    [gene|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|mmgA]-[gene|FB95ABDC8557F26525E8B211595C130A7203ABC0|mmgB]-[gene|F25CDDEBAFC72036664323619F5197D45E86BE9A|mmgC]-[gene|3DB116F7423C31838ED6EE090B94DA5F93A4F40C|mmgD]-[gene|602EAB591A550F68C14F35F6E5F0A91C3B997343|mmgE]-[gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]
    description
    [Pubmed|8759838]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8759838], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8759838], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|15699190,8759838]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C374 (yqiQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2372 NBRP B. subtilis, Japan]
  • BKE24120 ([gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGACATGAAACAAAATCCCC, downstream forward: _UP4_TAATGCAACAAAAAAAGCCG
  • BKK24120 ([gene|2F4A025B8E3F14764D24CD7E33F7608C2EB1C42C|mmgF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGACATGAAACAAAATCCCC, downstream forward: _UP4_TAATGCAACAAAAAAAGCCG
  • References

  • 12706720,8759838,15699190,28956599