SubtiBank SubtiBank
ykpA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykpA

[SW|ABC transporter] (ATP-binding protein)
locus
BSU_14430
pI
4.98
mw
60.88 kDa
protein length
540 aa Sequence Blast
gene length
1623 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • Gene

    Coordinates
    1,512,373 1,513,995

    The protein

    Catalyzed reaction/ biological activity

  • may be involved in a ribosome-associated function, based on results with the E. coli counterpart [pubmed|30597160]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|ABCF ATPase subfamily] [pubmed|30597160]
  • Paralogous protein(s)

  • [protein|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|YfmM], [protein|F69F15198ACF8A8347C450EEC09F000EECEDEC41|YfmR], [protein|1F56D3275386BB54A774BFA045C09E36D1268471|YdiF]
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 2-252, aa 320-537) (according to UniProt)
  • Structure

  • [PDB|3J5S] (EttA from E. coli, 33% identity) [pubmed|24389465]
  • [PDB|4FIN] (EttA from E. coli, 33% identity) [pubmed|24389466]
  • Expression and Regulation

    Operons

    genes
    [gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]-[gene|60264E4BE76F5995A8317294D05FC27F8B34E09D|ykpB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B352 (ykpA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1351 NBRP B. subtilis, Japan]
  • BKE14430 ([gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTATCCTCCATCAT, downstream forward: _UP4_TAAAAAAGCAGAGATTTCTC
  • BKK14430 ([gene|2F79DB15D359A127C2D833CC0465E18E1725F539|ykpA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATTATCCTCCATCAT, downstream forward: _UP4_TAAAAAAGCAGAGATTTCTC
  • References

    Reviews

  • 24500425,30746819
  • Original publications

  • 10092453,24389466,24389465,27006457,30597160