SubtiBank SubtiBank
yddJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yddJ

ICEBs1 exclusion factor
locus
BSU_04990
pI
4.52
mw
14.54 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
prevention of redundant transfer of ICEBs1 into host cells that already contain a copy of the element
product
ICEBs1 exclusion factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    545,595 545,975

    The protein

    [SW|Localization]

  • putative lipoprotein, attached to the cell membrane [pubmed|31361051]
  • Expression and Regulation

    Operons

    genes
    [gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    genes
    [gene|EE2A4068CBD7A2F852E582E2EDA4148381F1CD61|xis]-[gene|2227923C603B290AB276238F789D71584FB07DF3|ydzL]-[gene|34451538F10B4ABCFC8A236C8C905A20D989EBCF|ydcO]-[gene|C042792D9A643DCFF4A851EFECA3CF2C31E1EDAF|ydcP]-[gene|4BCAA5939CB7F0DF23495BC92C9EF0A0149296A0|ydcQ]-[gene|8E179976C35FE09F92A191D00E497ED4BF28F571|nicK]-[gene|886B2132717BA4C72433ABE351C5791C9DE1432A|S172]-[gene|1699CFBF5400CAF43C6DAE8ADCCE5A360B31F2E9|ydcS]-[gene|9D4918852A1856B1CDD72D49AEA75E51A8602BB6|ydcT]-[gene|62CEABA069CA2970F22B7E0C369D540A2A027A8D|yddA]-[gene|A0AFD543582D2FE8B1139CF69B7B1F7FF0F80265|conB]-[gene|F273A8817E66B44D58FC2BCB6576A30D8616B750|conC]-[gene|F1F898D7A9FDF78D2E5E8F3BF605E0F735D0542A|conD]-[gene|D20F724D8C3E8C758A9FADF133CD43F066BD8D48|conE]-[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]-[gene|3356A43B83E2D4D66098F17A751F0912C1553398|conG]-[gene|8D9D81E05BAA8697F002BB1B8DBC5ABBA557353F|cwlT]-[gene|2E4FF80C857B3F40BA835814EC40D6562721AEFE|yddI]-[gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • regulation

  • strongly induced in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials

    Mutant

  • BKE04990 ([gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATAAACATTACCTCCT, downstream forward: _UP4_TAAACCGTGTGTTTACTCCT
  • BKK04990 ([gene|2FB1C9435AE924F8E450AFA81F800196A871F2D0|yddJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATAAACATTACCTCCT, downstream forward: _UP4_TAAACCGTGTGTTTACTCCT
  • References

  • 20817675,31361051