SubtiBank SubtiBank
efp
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

efp

elongation factor P, important for the [category|SW 3.3.1|Translation] of proteins containing three or more consecutive proline residues
locus
BSU_24450
pI
4.84
mw
20.31 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
[category|SW 3.3.1|Translation]
product
elongation factor P
essential
no
synonyms
yqhU,yqgF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.11|Translation factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • Gene

    Coordinates
    2,538,115 2,538,672

    Phenotypes of a mutant

  • impaired swarming motility [Pubmed|15066026,27002156]
  • inactivation of ''[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]'' reduces sporulation efficiency to 1% that of wild type cells [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • see a list of [category|SW 6.11|Efp-dependent proteins]
  • Protein family

  • elongation factor P family (single member, according to UniProt)
  • Modification

  • carries a 5-aminopentanol moiety at Lys-32, this modification is essential for activity [Pubmed|27002156]
  • Structure

  • [PDB|6RK3] (from Staphylococcus aureus, 71% identity) [pubmed|32152681]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation

    Operons

    genes
    [gene|449EEBF33F52B461F244331ACD140E68CF64EE7C|yqhR]-[gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|D7503C73C0BC2E411C651E409E91C2E22E8842E5|yqhS]-[gene|33886A1EAC13B684E92BF94201C46617AD2844B3|papA]-[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C464 (efp::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2462 NBRP B. subtilis, Japan]
  • BKE24450 (''[gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE24450 ([gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAATGTCCTCCTAT, downstream forward: _UP4_TAGAAAGAAAAAAAGAAGTC
  • BKK24450 ([gene|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|efp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAATGTCCTCCTAT, downstream forward: _UP4_TAGAAAGAAAAAAAGAAGTC
  • References

    Reviews

  • 26416626,28886684,32011712
  • Original publications

  • 15066026,17981983,23239624,23239623,25310979,25144653,27002156,26735940,27216360,26384033,28787546,28765223,29615499,30297417,32152681