SubtiBank SubtiBank
deoD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

deoD

purine nucleoside phosphorylase
locus
BSU_19630
pI
4.98
mw
25.23 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
function
purine salvage and interconversion
product
purine nucleoside phosphorylase
essential
no
ec
2.4.2.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • Gene

    Coordinates
    2,135,470 2,136,171

    The protein

    Catalyzed reaction/ biological activity

  • purine D-ribonucleoside + phosphate --> purine nucleobase + α-D-ribose 1-phosphate (according to UniProt)
  • purine 2'-deoxy-D-ribonucleoside + phosphate --> 2-deoxy-α-D-ribose 1-phosphate + purine nucleobase (according to UniProt)
  • Protein family

  • PNP/UDP phosphorylase family (with [protein|5B21D1E73A65B13CE4DDA32ABC71EFA54E8D1D8F|MtnN], according to UniProt)
  • Structure

  • [PDB|4D8V] [Pubmed|22957058]
  • Expression and Regulation

    Operons

    genes
    [gene|3075327DBE55C4F628171AEE248CAED5870693FA|deoD]-[gene|9A22825FD67B6A205807433D0B4908F86E5AB343|ldcB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE19630 ([gene|3075327DBE55C4F628171AEE248CAED5870693FA|deoD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATATCCTCCTGTAA, downstream forward: _UP4_TAAAATATATCAAGAGGCGT
  • BKK19630 ([gene|3075327DBE55C4F628171AEE248CAED5870693FA|deoD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATATCCTCCTGTAA, downstream forward: _UP4_TAAAATATATCAAGAGGCGT
  • References

  • 21424839,16511068,22957058,22383849