SubtiBank SubtiBank
nprE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nprE

extracellular neutral protease B
locus
BSU_14700
pI
7.48
mw
56.35 kDa
protein length
521 aa Sequence Blast
gene length
1566 bp Sequence Blast
function
degradation of proteins
product
extracellular neutral protease B
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.2|Extracellular feeding proteases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,540,036 1,541,601

    The protein

    Catalyzed reaction/ biological activity

  • Similar, but not identical, to that of thermolysin (according to UniProt)
  • Protein family

  • peptidase M4 family (with [protein|57139471EB143F6DCCF092DAD0FBB43B0D50D948|NprB], according to UniProt)
  • Paralogous protein(s)

  • [protein|57139471EB143F6DCCF092DAD0FBB43B0D50D948|NprB]
  • Structure

  • [PDB|1NPC] (of ''Bacillus cereus'')
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|1906467], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|26728191], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during exponential growth ([protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]) [Pubmed|1906467]
  • additional information

  • in a triple ''[SW|abrB] [SW|codY] [SW|scoC]'' mutant, expression occurs during exponential growth [Pubmed|26728191]
  • view in new tab

    Biological materials

    Mutant

  • KO7 (''nprE aprE epr mpr nprB vpr bpr''), available as BGSC 1A1133
  • BKE14700 ([gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAATCCCCCTTTTT, downstream forward: _UP4_TAATATTAGGAAAAGCCTGA
  • BKK14700 ([gene|309EAC680ABFF0B736E01F0B9BDFBB2FCBDB1BBF|nprE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAATCCCCCTTTTT, downstream forward: _UP4_TAATATTAGGAAAAGCCTGA
  • References

    Reviews

  • 20735481
  • Original publications

  • 1906467,18957862,20817675,24115457,26728191