SubtiBank SubtiBank
yxaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxaD

similar to transcriptional regulator ([SW|MarR family])
locus
BSU_40010
pI
6.76
mw
16.70 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    4,109,185 4,109,616

    The protein

    Protein family

  • [SW|MarR family]
  • Expression and Regulation

    Operons

    genes
    [gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B761 (yxaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1760 NBRP B. subtilis, Japan]
  • BKE40010 ([gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGCTCTCGCTCCCTAT, downstream forward: _UP4_TAACAGCTGAAAAACCCATG
  • BKK40010 ([gene|30E52226538965F2AF1EC34F5E4A14CA8B4CDE26|yxaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGCTCTCGCTCCCTAT, downstream forward: _UP4_TAACAGCTGAAAAACCCATG
  • References

  • 16479537,10746760