SubtiBank SubtiBank
ysnE
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ysnE

similar to acetyltransferase
locus
BSU_28330
pI
5.76
mw
16.91 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,898,292 2,898,747

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 3-151) (according to UniProt)
  • Structure

  • [PDB|1YX0]
  • Expression and Regulation

    Operons

    genes
    [gene|30F6A051E8035A9479FDAE89690132491554CE59|ysnE]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A994 (ysnE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/994 NBRP B. subtilis, Japan]
  • BKE28330 ([gene|30F6A051E8035A9479FDAE89690132491554CE59|ysnE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTCCTCCTCGAA, downstream forward: _UP4_TGAGACGGCTTTATAAGGAT
  • BKK28330 ([gene|30F6A051E8035A9479FDAE89690132491554CE59|ysnE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTCCTCCTCGAA, downstream forward: _UP4_TGAGACGGCTTTATAAGGAT
  • References

  • 8969504