SubtiBank SubtiBank
ysnE
The papers of the month are back! Check them out! Link here

ysnE

similar to acetyltransferase
locus
BSU28330
pI
5.76
mw
16.91 kDa
protein length
151 aa Sequence Blast
gene length
453 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,898,292 → 2,898,747

    The protein

    Protein family

  • acetyltransferase family (according to Swiss-Prot)
  • Structure

  • [PDB|1YX0]
  • Expression and Regulation

    Operons

    genes
    [gene|30F6A051E8035A9479FDAE89690132491554CE59|ysnE]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A994 (ysnE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/994 NBRP B. subtilis, Japan]
  • BKE28330 (Δ[gene|30F6A051E8035A9479FDAE89690132491554CE59|ysnE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTCCTCCTCGAA, downstream forward: _UP4_TGAGACGGCTTTATAAGGAT
  • BKK28330 (Δ[gene|30F6A051E8035A9479FDAE89690132491554CE59|ysnE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTTATTCCTCCTCGAA, downstream forward: _UP4_TGAGACGGCTTTATAAGGAT
  • References

  • 8969504