SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cystathionine lyase/ homocysteine gamma-lyase
40.73 kDa
protein length
379 aa Sequence Blast
gene length
1137 bp Sequence Blast
methionine-to-cysteine conversion
cystathionine lyase/ homocysteine gamma-lyase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • Gene

    2,785,001 → 2,786,140

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L,L-cystathionine --> 2-oxobutanoate + L-cysteine + NH4+ (according to UniProt)
  • H2O + L-homocysteine --> 2-oxobutanoate + H+ + hydrogen sulfide + NH4+ (according to UniProt)
  • Protein family

  • trans-sulfuration enzymes family (with [protein|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|MetI] and [protein|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|MetC], according to UniProt)
  • Paralogous protein(s)

  • [protein|04DC792180FDC5E7916F2DBB2EC2C34369202FE0|MetI], [protein|1C0D38F23D3A2CAA1EB057A92D6F571D0D2AA724|MetC]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|4L0O] (from Helicobacter pylori, 61% identity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16513748], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,16885442], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|search|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials


  • MGNA-A848 (yrhB::erm), available at the [ NBRP B. subtilis, Japan]
  • 1A942 ( ''mccB''::''kan''), [Pubmed|17056751], available at [ BGSC]
  • 1A945 ( ''mccB''::''kan''), [Pubmed|17056751], available at [ BGSC]
  • BKE27250 (Δ[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCAATGTTTTTTTCT, downstream forward: _UP4_TAACAAATGGATAGAATTAC
  • BKK27250 (Δ[gene|314CB4923D15140E72B0ABAFE3E8BE9CA7310E10|mccB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATCATCAATGTTTTTTTCT, downstream forward: _UP4_TAACAAATGGATAGAATTAC
  • References

  • 17056751,16513748,16885442,12642660