SubtiBank SubtiBank
ytpP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytpP

similar to thioredoxin H1
locus
BSU_29840
pI
4.30
mw
12.61 kDa
protein length
107 aa Sequence Blast
gene length
324 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • Gene

    Coordinates
    3,054,188 3,054,511

    The protein

    [SW|Domains]

  • [SW|Thioredoxin domain] (aa 1-105) (according to UniProt)
  • Structure

  • [PDB|4RUV] (Thioredoxin-2 from Staphylococcus aureus, 32% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|314D5C01B4BDDC3B122F6D4066647B143B2A6543|ytpP]-[gene|886EF2F8A9E031FDF919E01A858C1DBC1AFF1188|ytpQ]-[gene|EE559CD606562097F09DC627F431CA31129D7BC6|ytpR]
    description
    [Pubmed|21949854]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21949854], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|21949854], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B531 (ytpP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1530 NBRP B. subtilis, Japan]
  • BKE29840 ([gene|314D5C01B4BDDC3B122F6D4066647B143B2A6543|ytpP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATATCCCTCCAGTT, downstream forward: _UP4_AAAGCGTAAAGGAGGACATC
  • BKK29840 ([gene|314D5C01B4BDDC3B122F6D4066647B143B2A6543|ytpP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATATCCCTCCAGTT, downstream forward: _UP4_AAAGCGTAAAGGAGGACATC
  • References

  • 21949854