SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


general stress protein, similar to alcohol dehydrogenase
30.93 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    471,709 472,569

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF], [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC]
  • [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG]:
  • [protein|4DEFC2998464BF8327578C36A13A10DD277F991E|YkvO]:
  • [protein|6047F2493FCE3D2A9BDB1AD88E5926ECEED81036|YhxC]:
  • [protein|739B228743BC1FE9E6888E999BC0E4F615E36F9E|YhxD]:
  • [protein|B6FF689E65906186F3576B378650D713DB84EDDA|YcdF]:
  • [protein|CA4597C6253CCF7D7954686A30AF041808BDF8E5|Gdh]:
  • [protein|D9D1FCBFC62F93CAA34DF61A784406F4E9EE6768|YjdA]:
  • [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD]:
  • [protein|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|BacC] (34.3%), [protein|439B468A13137000FB42E9389391CB4986FFED84|FabG] (31.1%), [protein|FBBDE1E058223D5E8CEB07CAA50940A329C809E4|KduD] (36.7%), [protein|EAEEA4DD9641919830A81185333A2610B964D37C|YhdF]
  • Structure

  • [PDB|3I30] (from ''Bacillus Anthracis'', 61% identity)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab


    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C086 (ydaD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04190 ([gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCTCCTCCTTT, downstream forward: _UP4_ACGACATAAGAGGGAGTGAG
  • BKK04190 ([gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGATTCTCCTCCTTT, downstream forward: _UP4_ACGACATAAGAGGGAGTGAG
  • References

  • 10220166,15805528,23033921