SubtiBank SubtiBank
ylmE

ylmE

pyridoxal phosphate-binding protein, involved in controlling the availability of coenzyme A
locus
BSU_15380
pI
5.55
mw
25.56 kDa
protein length
230 aa Sequence Blast
gene length
693 bp Sequence Blast
function
control of the CoA pool
product
pyridoxal phosphate-binding protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,610,170 1,610,862

    The protein

    Catalyzed reaction/ biological activity

  • while the protein was described as an amino acid racemase important for biofilm formation [Pubmed|20431016], no racemase activity was detected in ''in vitro'' assays with a functionally active protein [Pubmed|24097949]
  • Protein family

  • pyridoxal phosphate-binding protein YggS/PROSC family (single member, according to UniProt)
  • [SW|Cofactors]

  • pyridoxal phosphate [Pubmed|24097949]
  • Structure

  • [PDB|1W8G] (the structure of YggS from ''E. coli'' 33% identity, 61% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|ECCE99438DBFC52DA7236CB4F6486DD004CADF73|ylmD]-[gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]-[gene|DB09F1C36257F511A84A083967A25A9D46744D14|sepF]-[gene|2B2D285D5A8F160808A21DCF07BDB924365970C5|ylmG]-[gene|BD5ACF930DD63E258D71569326752C9A1D7B9324|ylmH]
    description
    [Pubmed|16420366]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B363 (ylmE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1362 NBRP B. subtilis, Japan]
  • BKE15380 ([gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTATCAACAACACGCAAGA, downstream forward: _UP4_AATGAAACAGGGGGTGTACA
  • BKK15380 ([gene|31789A170CB624BF8210C915F40007F802F5C81B|ylmE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTATCAACAACACGCAAGA, downstream forward: _UP4_AATGAAACAGGGGGTGTACA
  • References

  • 14651647,16420366,24097949,26872910,30902856